De fleste mennesker, som tror på kreationisme, gør det, fordi de blev opdraget som kristne, og de tror på Bibelen (oven i købet lidt for bogstaveligt). På den anden side lader der til at være tre hovedbegrundelser for, at folk tror på darwinismen: de er blevet undervist i det i skolen, de har kun en vag forståelse for den tilgrundliggende videnskab (eller mangel derpå, som vi vil se), og/eller de er overbeviste om, at kreationisme er nonsens, og de tror, at deres eneste andet alternativ er darwinisme. Der er imidlertid væsetlige problemer ved alle tre begrundelser.
For det første er den måde, som darwinisme bliver undervist på i skolen ekstremt besnærende og denne omstændighed ville kræve en artikel for sig selv, men jeg vil skitsere, hvad der er galt med darwinismen i almindelighed og med den måde, hvorpå den bliver præsenteret for os.
For det andet hindrer den vage forståelse af videnskaben og kendsgerningerne, der er relevante for evolution, dem i at se darwinismens talrige problemer. Den opfattelse, at organismerne udviklede sig trin for trin, er let at sluge, når du ikke har nogen klar ide om, hvilke trin, der præcist burde være, og hvordan præcist udviklingsmekanismen tænkes at fungere. Uden en klar ide om, hvordan cellen ser ud, hvad den indeholder, hvor kompleks den er, og hvordan den fungerer, og hvad DNA gør, efterlades man kun med hovedpunkter, som bekræfter, at det hele virkeligt fungerer, og at videnskaben har bevist det (og at kun uvidne mennesker stiller spørgsmål til det.) Du får sjældent mulighed for at høre, hvor spinkel denne videnskab faktisk er, og hvor usikre beviserne er, og hvor mange videnskabsmænd, der er uenige med mainstream-fortællingen. Anti-darwinistiske ideer er ofte helt bogstaveligt forbudt i skolerne, sædvanligvis med den falske påstand om at de ikke er videnskabelige. Sand videnskabelig tænkning er imidlertid yderst mangelfuld i darwinismen selv.
For det tredje, darwinisme og kreationisme er ikke dine eneste valgmuligheder. Dette er ikke et valg, hvor man skal vælge mellem to kandidater. Ligesom ved et valg mellem to præsidentkandidater, hvis du tillader dig selv at blive overbevist om, at det er dine eneste valgmuligheder, så har du allerede tabt. Antagelserne om, at enhver, som ikke er en darwinist, må være en kreationist, og at hvis man ikke er en kreationist, så må man være en darwinist, er falske.
Der er kreationisme, der er darwinisme og så er der sandheden. Denne sjældent bemærkede tredje mulighed er det, som jeg ønsker at fokusere på i denne artikel. Og for at finde sandheden, må vi prøve at identificere løgnene. Jeg vil ikke tale om kreationisme, fordi den er baseret på en fiktion og det handler om at få kendsgerningerne til at passe ind i en bogs fortælling. I øvrigt vil ingen mængde af beviser få kreationisterne til at flytte sig fra deres trosopfattelser. Min pointe er at vise mennesker, som passivt tror på, at darwinismen er sand, men aldrig har foretaget nogen alvorlig undersøglse for at bekræfte eller benægte denne, at darwinismen er behæftet med massive fejl og at identificere dem ikke behøver at lede os i retning mod kreationisme.
Mit grundlag for argumentet mod darwinisme er videnskab, specielt videnskabelige opdagelser fra de sidste få årtier. Darwinismen sidder fast i den første halvdel af det 20. århundrede. Der er intet behov for at påkalde gud for at påvise, at darwinistisk evolution ikke fungerer som beskrevet. At tro på darwinismens evne til at forklare evolution drejer sig ikke om, hvor meget du ved, men om hvor meget, du er villig til at ignorere.
Det burde også påpeges, at i almindelighed taler vi ofte om ting, for hvilke der ofte er ustilstrækkelige klare beviser og mange af beviserne, som vi har, kan fortolkes. Forskellige mennesker har forskellige fortolkninger af de samme kendsgerninger, meget påvirkede af deres egne verdensanskuelser og opfattelser. Nogle ting ved vi helt sikkert, men mange ting er meget mindre klare. I enhver evolutionsteori arbejder vi per definition med hændelser og processer, som foregik for længe siden, og vi kan studere nogle af dem alene ud fra spredte stumper evidens, som ikke omfatter den fuldstændige sammenhæng, der kræves for at forstå dem fuldt ud. I mange tilfælde, må vi ganske enkelt anerkende, at vi ikke ved noget, og at vores forskellige synspunkter bygger på teorier og spekulationer.
Jeg vil inddele denne artikel i tre hovedafsnit: hvad præcist er den Darwinistiske evolutionsproces, og hvordan antages den at virke, hvorfor den ikke gør og ikke kan gøre det, som den påstår den kan, og hvad det betyder for os.
Kommentar: Delvist oversat af Sott.net fra Darwinism, Creationism... How About Neither?
På den oprindelige side er der, ganske vist på engelsk, allerede oplysende læserkommentarer.
What the Darwinian Theory of Evolution Really Says
The process by which evolution supposedly happens is Natural Selection (NS) acting upon Random Mutation (RM). RM means errors that occur in DNA. NS is a passive natural process that just notes that whatever survives long enough to reproduce gets to pass on its genes. RM is the driving force that provides raw material; NS is what's supposed to sort it out and separate the good from the bad. In reality, not only is the raw material provided by randomness of inferior quality, as you might expect, but NS has far less power than the Darwinists would have you believe.
To appreciate how it all works, we need to have some idea about what happens in the cell and what exactly these mutations are. How well could you answer questions like these:
- How complex is a cell?
- What exactly is DNA and what does it do?
- What is the relationship between DNA, a gene, and a chromosome?
- What are amino acids and what do they do?
- What are proteins, where do they come from, and what function do they serve?
- When we talk about mutations, what exactly mutates, where and how?
So let me first explain some basics of what goes on inside a cell. This will get a bit technical for a few paragraphs.
You've probably seen the DNA helix. It's like a long twisted ladder. Each step of the ladder is called a base pair. There are only four bases: A[denine], T[hymine], C[ytosine], and G[uanine]. A always connects to T, and C always connects to G. So it looks something like this:
A--T
G--C
C--G
T--A
C--G
A--T
A--T
G--C
A very long string of such DNA, up to hundreds of millions of base pairs, nicely folded, forms a chromosome. Humans have 46 such chromosomes in the nucleus of each cell. A gene is a section of a chromosome. Among other things, it's a set of instructions (a string of the ATCG code) for building a protein. A chromosome can contain anything from hundreds to a few thousand genes.
RNA is like DNA but with only one strand (one side of the ladder) and has many functions, and many things inside a cell are built from RNA.
The DNA code of sequences like TCGATCACGTACAGGTCAGC is similar to our computer code with sequences like 10010110101101001. A sequence of 1s and 0s may contain instructions for how to play a video file; a sequence of the four letters A, T, G and C contains instructions for coding proteins and much more. The 46 chromosomes in each human cell contain all the information needed to build and maintain the whole human body.
To get an idea how complicated this all is, let me outline how proteins are made. An enzyme attaches itself to DNA, runs through it (or part of it), copying one of the strands and thus creating mRNA (messenger RNA). Specific sequences of letters will tell it where a gene begins and ends (kind of like headers in computer files). So it creates mRNA that's more or less a copy of one gene. (All processes are actually more complicated, but I won't get into introns and such things.) Now a ribosome (made itself from RNA and some proteins) attaches itself to the mRNA and starts "reading" it, codon by codon. A codon is a set of three nucleotides, for example ACG. (A nucleotide is the base plus the part of the DNA/RNA backbone that it attaches to. For our purposes, the difference between a base and a nucleotide is negligible).
For every codon, the ribosome needs to find tRNA with the correct anticodon. tRNA (transfer RNA) is a fairly small chunk of RNA with the anticodon on one end and a corresponding amino acid on the other. An anticodon is the complementary sequence to a codon, so if the mRNA has CCC, the tRNA needs to have GGG, in order to fit. A tRNA with GGG always carries the same amino acid. The tRNA molecules sort of float around, and when the ribosome finds the right one, it gets attached, and its amino acid is handed over to the ribosome. Then the mRNA shifts to the next codon in the ribosome, waiting for the ribosome to find the next tRNA and thus another amino acid. The amino acids get connected together and form a long chain - a protein, which will be dozens to thousands of amino acids long. Proteins then do all kinds of work in the body.
You don't really have to understand this; the reason I'm describing it is to give you just a little insight into the complexity of the processes that go on in every single cell, all the time. There is of course infinitely more than this. A cell is like a busy city, with countless things going on simultaneously, and none of it is simple. Things have to be transported from place to place, you have to make things that make other things, and so on.
The image above is of a single cell - the basic unit of organic life. The smallest things you see here, ribosomes, are complex machines that play a major role in translating mRNA into proteins. None of this is even remotely simple.
John Sanford explains in Genetic Entropy:
A complete human genome consists of two sets of 3 billion individual letters each.The inner workings of a cell are incredibly complex, and the information contained in it (remember that all the chromosomes with all the DNA are in the nucleus) is mind-boggling. The ATCG code of DNA is just its most basic element. There are control regions, there's DNA folding, and many levels of complexity above the code itself.
In addition to multiple, overlapping, linear, language-like forms of genetic information, the genome is full of countless loops and branches, like a computer program. It has genes that regulate genes that regulate genes. It has genes that sense changes in the environment and then instruct other genes to react by setting in motion complex cascades of events that can then respond to the environmental cue. Some genes actively rearrange themselves, or modify and methylate other gene sequences, basically changing portions of the instruction manual!
Now that we have some idea about what the code that builds everything looks like, let's move to what random mutations are. Say at one specific point in the DNA you have an A--T base pair. A copying process reading the A makes a mistake of some kind. This is the mutation. There are several variations of what can happen. The A can be changed into any of the other three bases, so instead of A--T, you can get T--A, C--G, or G--C. Another option is that the A gets skipped/deleted, and the deletion can cover any number of base pairs. Then there's insertion, which means that before the A, one or more bases get inserted from somewhere else, and our A shifts in the sequence. There's also duplication, meaning the A, or even a whole sequence like AACGCTTC, gets copied an extra time, or two, or 25. So, basically, random mutations are the various glitches that can occur to this ATCG code in the DNA.
Most of these glitches, like any errors anywhere, won't result in anything good. If you have a piece of a gene, or of DNA, like ACGTAGGCA, it will be divided during protein translation into ACG, TAG, and GCA, and these will code for three amino acids. But if something gets inserted at the beginning, say G, you get GACGTAGGCA, which then splits into GAC, GTA, and GGC, which codes for completely different amino acids than the original sequence, because the whole code sequence was shifted. Similar shifting would occur with a single deletion. Because these sequences are functional and very specific in the first place, it is extremely unlikely that any error will produce anything that works better than the original - in fact, it may not work at all.
The genetic code is something that works well as it is. Random mutation introduces random changes to the code. For comparison: a book is something that works as it is. Random mutation would introduce random changes to the letters of the text. The idea of getting a new functional organ in the body this way is akin to getting a new functional (i.e. intelligible) chapter in a book this way. But this is the core mechanism by which Darwinists claim all life on Earth has evolved! If you imagine the book as an instruction manual for building something specific, what are the chances that random changes in the manual will result in building something better? I'm sure you can see that the chances are practically zero. And as we'll see later, natural selection can do little to help.
According to Darwinism, a bacterium has, literally, accidentally evolved into a human through the accumulation of random copying errors in its DNA. Please take a few minutes to ponder how dumb this idea is.
Does it make sense that randomness creates complex, functional order? Something that's functional, that works, that does things, doesn't appear randomly. Can you imagine randomly shuffling or changing some of the components of a functional device, like a smart phone, with the result that it works better? Clearly, making random errors is not the way to improve a functional system.
Darwinists believe that this is where natural selection (NS) steps in and fixes everything. But NS can only act on something that's there, and what's there is random changes. If what NS has to work with are random changes to something that already works, there's extremely little space for improvement of any kind.
Everyone seems to agree that genetic code is more sophisticated and complex than anything humans have ever designed. So think about this:
- It takes the smartest of us, and a lot of effort, to intelligently design the sophisticated technology we have today, like supercomputers.
- Yet according to Darwinists, something much more complex than anything we've ever designed just arose out of random errors.
There is abundant evidence that most DNA sequences are polyfunctional, and are, therefore, poly-constrained. This fact has been extensively demonstrated by Trifonov (1989). For example, most human coding sequences encode for two different RNAs that read in opposite directions (i.e., both DNA strands are transcribed - Yelin et al., 2003). Some sequences encode for different proteins, depending on where translation is initiated and where the reading frame begins (i.e., read-through proteins). Some sequences encode for different proteins based upon alternate mRNA splicing. Some sequences serve multiple functions simultaneously (i.e., as a protein-coding sequence and as an internal transcriptional promoter). Some sequences encode for both a protein-coding region and a protein-binding region.So the same chunk of DNA can code for several different things, depending on how it's read and translated. Even if by introducing random changes to one function of a multifunctional operation were to, by chance, improve one function, it would most definitely break the other functions. Darwinism is a theory that claims insurmountable obstacles are regularly being overcome, again and again, like it's the most natural thing.
If you let it sink in, you'll see that the more you think about it, the more it looks like the dumbest theory ever conceived.
Can you think of one example of something in our world where a random process creates something complex and functional? Random processes can at best create interesting patterns, but those don't do anything. One might argue that, maybe, once in a very long time, a number of random mutations could somehow accumulate and produce something new and complex. Let's allow that, for the sake of argument (though we will see that this is just a dream, for many reasons). But how many such mutation complexes, each consisting of dozens to hundreds of single mutations, do you think you'd need to get from a fish to a bear? Hundreds? Thousands? And you'd need the same for all the other species. With every new step, the probability drops by orders of magnitude. And for evolution to work as described, this would have to happen all the time. Billions of such sequences of events would have to occur, where even one is massively improbable, if possible at all.
If you ask, 'where did all this life come from?', Creationists say, 'God did it'. Darwinists say this explanation is lazy. But if you ask them to answer that question, they'll say 'it happened randomly'. That's an even lazier explanation, and makes even less sense. The whole Darwinian view of how things work is extremely simplistic and naive. (Just like Creationism).
The principle of entropy says that, over time, everything degrades, moves from more complicated and unusual to more simple and normal, from a state of lower probability to a state of higher probability, from order to disorder. But the theory of evolution directly contradicts entropy. According to it, information in the genome gets progressively more complex on its own, by a random process, with no intelligent input. This is illogical and nonsensical. Meaningful information doesn't arise randomly, and consciousness doesn't accidentally spring from dead matter. Yet that is exactly what Darwinism relies on to work. It claims that a random process with no intelligence and no goal produces information, consciousness, and intelligence. Your reading this and thinking about it is a result of molecules long ago randomly assembling into functional genes, which later led to creating you and your thoughts - as a completely random side effect! That's the story. But nothing in our world works like that. You can't get more out of something than you put in. If the input is random garbage (mutation, errors), the output can't be something functional and more complex than the original.
The Many Shortcomings of Darwinism
Let me start this part with a little example. The other day I was reading Richard Dawkins's The Greatest Show on Earth, his only book where he even tries to explain why Darwinism is true. (In all his other books, by his own admission, he simply assumes it's true and starts from there.) Here he mentions something from Richard Lenski's experiment with E. Coli. (Lenski has been breeding and studying E. Coli for decades. It's one of the most extensive real-life experiments with 'evolution').
Dawkins says one of the groups of the bacteria evolved mutation A, which on its own "did absolutely nothing", and then later evolved mutation B, which on its own also did absolutely nothing, but because mutation A was already present, they did something together. (It took tens of thousands of generations to get there.)
According to Dawkins, this shows "evolution right in front of our eyes", shows that "new information can enter the genome", and "undermines the dogma of irreducible complexity." If your only sources of information about evolution are school textbooks and Dawkins, and you don't think about things much, you might not see a problem with this. But there are several, and this is a good representation of how Darwinists regularly distort things.
- Dawkins doesn't tell us anything about what A and B were and what they did together. This gives us little idea of what's really going on.
- He fails to mention what "new information" appeared and how it was really new, rather than just a modification of the old.
- His notion of 'complexity' is two (2) parts.
- He says nothing about how "mutation A" passed through natural selection when it did "absolutely nothing" without mutation B.
- Of course it wouldn't occur to him to even wonder how the genetic code might have been damaged by whatever happened there.
1. Without knowing exactly what he's talking about, we have little choice but to accept his interpretation of what happened. But that's a huge problem. The information given is deliberately vague, and thus it's impossible to judge whether his interpretation is correct. And this is a key element of the manipulation by people like Dawkins and by our poor education systems: you don't get facts; you get interpretation of data with insistence that it's a fact. In contrast, if you read Michael Behe's books, which explain why Darwinism cannot account for much of evolution, you get everything explained down to the minutest details, so you can understand very clearly what's going on, and you can much better judge whether you're being lied to.
2. As you might already have deduced after reading the first part of this article, there's no real way to get 'new information' into the genome by random mutations. Everything is just a modification of what's already there, and those modifications are a thousand times more likely to break something than improve it. Dawkins says that new information entered the genome, but we have no idea what it is and thus whether this claim is true.
3. Irreducible complexity is explained in great detail in Behe's book Darwin's Black Box. To recapitulate quickly: if you have a system of 20 parts that are all needed for the system to work (remove any one part and the system becomes useless), the system cannot evolve step-by-step in Darwinian fashion, because you'd have 19 intermediate states that aren't useful for anything and thus NS wouldn't select them. This is one of the biggest problems for Darwinism. Dawkins claims 'victory' because he shows something evolved two parts that did something together. Two parts is the worst example of 'complexity' possible (literally), and on top of that his explanation has so many holes in it, it's not even funny.
4. Supposedly mutation A did "absolutely nothing" on its own. Then how is it possible for it to be selected by NS? This is the key element of Darwinian evolution. If it does nothing, it has no benefit to survival and therefore won't survive. So you'd expect an explanation of how it spread in the genome. Instead, Dawkins completely ignores the issue. How then are we to take seriously anything he says?
5. Whatever really went on in Lenski's experiment (we really have no clue from Dawkins's account), it's much more likely that, along with something that increased survival, some part of the genetic code broke, than that 'new information' was introduced. (I'll return to this experiment a bit later.) But Dawkins, along with most other Darwinists, ignores this as well. He sees only what he wants to see and interprets it in a way that suits his pre-formed belief.
Sadly, many people read his books with barely a basic understanding of the topic, and so they're easily convinced by his conclusions, never noticing all the manipulation, inconsistencies, fallacies, and omissions, and they think he's a genius who shows those dumb Christians how things really work. Sure, Christians may have some pretty dumb ideas, but unfortunately, Dawkins is just as ideologically-driven and therefore just as dumb.
Earlier in the book he talks about dog breeding and concludes: "If so much evolutionary change can be achieved in just a few centuries or even decades, just think what might be achieved in ten or a hundred million years." Depending on how perceptive you are, you may or may not notice that dog breeding is by design and not random. You might also notice the fact that changing the sizes, shapes and colours of dogs only ever leads to different dogs and never to cats, gorillas, or eagles. It also consistently leads to genetic defects in most of the species. Dawkins bombards you with flawed arguments and ridiculous extrapolations, constantly insisting on how amazing evolution is.
Near the end of his book, Dawkins decides to explain how evolution fights entropy. According to him, natural selection is this amazing device that apparently creates new things (thus fighting entropy), and it can do that because it's constantly powered by the Sun! We'll see later just how much NS can really do and how it doesn't 'create' anything. What the Sun has to do with it is unclear, just like many of Dawkins's other ideas. The Sun provides energy, but the entropy is of information, which is neither energy nor matter. The only thing that can fight entropy of information is consciousness/intelligence. NS can, at best, slow it down by eliminating the very worst genetic material, but it can't reverse it.
If you want to learn more about this book's fallacies, omissions, and other flaws, check this blog by David Swift, author of Evolution Under The Microscope. He exposes the many ways in which Dawkins misleads the public.
Dawkins also ignores most of 21st (even late 20th) century science, as well as any other details that are inconvenient truths for his evolution argument, but people gobble it up because they don't know any better (which he relies on), and often because they just want a scientific-sounding confirmation that Creationism is wrong. Literally every aspect of Darwinism is controversial, at the very least (and often just patently false), yet Dawkins and others act like there's so much evidence for evolution that we need not look for more, and anyone who doesn't believe in it should really read his books and keep up.
Dawkins is the epitome of what's wrong with science today in general and Darwinism in particular. His books are based on materialist ideology, where dead stuff randomly performs advanced magic all the time. He is a persuasive propagandist and manipulator (taking a leaf out of the Global Warmists' book, he calls those who don't believe in Darwinian evolution "history deniers") who dogmatically repeats that evolution is a fact, evolution is amazing, everything springs out of randomness, natural selection is ingenious (even though it has an IQ of zero), and there's no meaning in anything... but the evidence for any of that is only imaginary. He writes 'popular science', which means there is very little actual science in it, so it's hard for the layman to judge the accuracy of anything he says. Everything is his interpretation of data that's presented in all kinds of distorted ways.
This problem also extends to how Darwinism is taught in schools where students are treated to endless repetition of the 'fact' that evolution is true (the evidence for which is either lacking or false, as we'll see) and omission of scientific discoveries of the last 50-70 years that show increasing problems with Darwinism.
Icons of Evolution, a book by Jonathan Wells, focuses on exactly this. It lists a number of 'icons' - ideas that are, even today, presented in biology textbooks as proof of evolution - that have long been known to be misleading, inaccurate, and even faked. These are things that 'everyone knows' because they went to school, except they happen to not be true. I'll go through some of them briefly. For a fuller explanation, I highly recommend reading the book.
The above image is a drawing of embryos of different species, showing that the early stages look almost the same for all of them. But what is omitted is the fact that these drawings were faked. Other than selecting species that are more alike than others that could have been chosen, Haeckel (who originally drew them) used the middle stages of development, while in the earliest stage, the embryos are more dissimilar, and more importantly, he intentionally changed the drawings to look more alike than they really are. Today we have actual photos of embryos, and the similarity drawn by Haeckel simply isn't there.
In the image above we see a peppered moth resting on a tree trunk. Dark moths are more visible on light trees, light ones on dark trees. Supposedly, during the industrial revolution, as trees got darker due to pollution, the dark forms became more common because they were better masked and thus hidden from birds who eat them. Natural selection!
What is omitted however is that most pictures of peppered moths on tree trunks have been faked. The moths were put there by the photographers. Experiments that were supposed to show natural selection in action were poorly designed, not very scientific, and it took years for somebody to point out that peppered months don't exclusively rest on tree trunks, unless you put them there. Controversy ensued and the whole thing was a debacle, but you still see this claim in textbooks as 'proof' of evolution.
The image above shows archaeopteryx, the alleged intermediate animal between reptiles and birds. What is omitted is the fact that later science showed that "archaeopteryx is not the ancestor of modern birds, and its own ancestors are the subject of one of the most heated controversies in modern science."
The image above is a four-winged fruit fly, which supposedly proves that it's possible to evolve something new. The second pair of wings was achieved by targeted mutations in the lab. What is omitted however is that the second pair of wings is nonfunctional and even then a combination of three specific mutations was required to achieve the second pair, and the experiment was, of course, an example of intelligent design. The wings were also not just added, but rather a different organ was used to create them. It just so happens that this organ was kind of important because it helps the flies maintain balance. And of course the wings were not anything 'new' because a fly already has wings and this was just an extra pair. So these mutants gained nonfunctional extra wings that got in their way, lost an organ that was useful, and they only survived in the lab under favourable conditions. In the wild they died out because - guess what - natural selection did not 'select' them because they were useless!
There are more examples, like Darwin's finches that don't really evolve into anything different, or the circular reasoning of evolution resulting in homology and homology proving evolution, but this should suffice. The point is that some of the best-known examples of 'proof of evolution' are bogus, yet they're still shown to students with no mention of the controversy (at best) and fakery (at worst) surrounding them. So if you're one of those people who believe that evolution is a proven fact because that's what they taught you in school, but you've never done any research of your own into this, I recommend reading Icons of Evolution to see just how 'proven' evolution really is.
You might also ask yourself: if there's supposedly so much clear and unquestionable evidence for evolution, why are they showing you fake evidence at school? And when you complain, they tell you that critical thinking does not include questioning the proven science of evolution. That's literally the opposite of critical thinking. You should be starting to get the sense that there's something wrong with this picture. Thomas Nagel summed up the problem quite neatly when he said, "the political urge to defend science education against the threats of religious orthodoxy, understandable though it is, has resulted in a counter-orthodoxy, supported by bad arguments, and a tendency to overstate the legitimate scientific claims of evolutionary theory."
So what's really going on with Darwinism? Does it work or not? The answer to that question is, unfortunately, not a simple yes or no.
Let us assume that when Darwin first proposed his theory in 1859, he didn't know what he was talking about. This is not an attempt to denigrate him. I think he actually did pretty well, for his time. But that's the caveat: 'for his time'. Back then, science thought a cell was a blob of goo, nobody knew how heredity worked, and the discovery of DNA code was relatively far into the future. So while Darwin observed variation and natural selection quite correctly, he didn't know where this variation came from, and he, along with everyone else at the time, imagined things to be orders of magnitude simpler than they really are. The word 'imagine' is very apposite here. Darwin's theory was about what he imagined, but he had (and could have had) no idea about the limitations of the process of NS acting upon variation.
Things really went wrong later, with the modern synthesis of the Neo-Darwinists. They had a better idea of how things worked, but instead of realising the limitations, they engaged in an almost fanatical promotion of RM+NS as the explanation for everything. Too much enthusiastic dogmatism, too little science. This could have been corrected in the second half of the 20th century, but instead, the dogmatism only strengthened, and Darwinism became driven by ideology rather than science, tightly connected to materialism and atheism. The arguments for evolution became, in their dogmatism and vicious strife to claim superiority over Creationism, very similar to Creationism. The Creationists want to prove there is God, the Darwinists want to prove that there isn't, and they both ignore any facts that don't fit their thesis. Winning the fight has become more important than the truth. Meanwhile science has made huge progress that has been ignored or twisted, Dawkins-style, to suggest something other than what it really indicates.
Regarding what RM+NS really can or cannot explain, the best work I've seen is by Michael Behe. In his books The Edge of Evolution and Darwin Devolves, using recent scientific discoveries, he shows that RM+NS do explain some adaptation for survival, but cannot account for complex evolution. More specifically, according to Behe, this process can be observed on the level of species and genera, but it fails to produce anything complex enough to create a new family or anything above. The main reason is irreducible complexity, which is way beyond the ability of RM+NS, even theoretically. Over 20 years ago, Behe challenged the scientific community to explain how a flagellum could arise by the Darwinian mechanism of RM+NS. To date, nobody has been able to do that or reconcile the fact that mutations which degrade the genetic code are at least 1,000 times faster than ones which might improve it (the latter being highly unlikely in the first place.)
This is the crux of the matter for Darwinism. Random mutations & natural selection do work, in principle, as described, but there's a rather low limit of what this process can achieve. This is something that Darwinists can't, or don't want to, understand. They use the reverse logic of 'if the easy is possible, then the difficult must be possible too'. They assume mutations can do anything, like a junkie who's so high he thinks he can fly. But they can't. Dog breeding will never create dogs with wings. They have no genetic material for that, and contrary to the dreams of Darwinists, NS would destroy any such process anyway. Darwinists have continually confused change in degree with change in kind.
So what do we have evidence for? Where we provably know of evolution (though more precisely adaptation) between one studied specimen and another, we mostly see degradation of the genetic code. Where we see apparent improvement in the genetic code between two specimens, we have no direct evidence of actual evolution. Darwinists simply assume it by default.
There is evidence for the process of mutation+selection working - for example, malaria adapting to drugs, Lenski's E. Coli experiment showing that bacteria can, for example, increase the efficiency of their metabolism, cichlids in African lakes diversifying into many species, and so on. But there's clearly a ceiling for the 'evolutionary' potential in all such cases. It's more about specialisation (usually at the cost of versatility) than evolution.
Behe describes it this way:
"The fundamental principle seems very likely to be this: minor random variations around a designed blueprint are possible and can be helpful, but are severely limited in scope. For new basic designs such as those at the biological level of family and above, additional information is necessary, information that is beyond the ability of mindless processes to provide."In the few decades we've observed them, Malaria and the HIV virus have gone through as much mutation as humans have in their entire history (because there are lots of them and they have a short generation span). And what do they have to show for it? Nothing much. Did they grow anything new? No. Did they change in any observable way? No. They're just resistant to a few of our drugs, which usually involves only single mutations. The virus is still a virus, and the bacterium is still a bacterium. No change in their nature, no new function.
As for Lenski's E. Coli experiment, all apparent progress came at a cost.
"... the bacterium has repeatedly thrown away chunks of its genetic patrimony, including the ability to make some of the building blocks of RNA. Apparently, throwing away sophisticated but costly molecular machinery saves the bacterium energy. Nothing of remotely similar elegance has been built. [...]This is the kind of detail you get from Behe, but not from Dawkins. The result of evolution for tens of thousands of generations is that things mostly break and nothing even remotely complex is created. Natural selection selects for survival under current conditions. It cares about nothing else. There's no planning, no concern for the overall quality of the genome.
The lab bacteria performed much like the wild pathogens: A host of incoherent changes have slightly altered pre-existing systems. Nothing fundamentally new has been produced. No new protein-protein interactions, no new molecular machines. As with thalassemia in humans, some large evolutionary advantages have been conferred by breaking things. Several populations of bacteria lost their ability to repair DNA."
This is one of the most important aspects of random mutation. The genetic code tends to degenerate much more than to improve, even within mutations that improve survival. An organism under stress can come up with a 'dirty hack' that helps, but breaks something much faster than with a constructive solution. And if that dirty hack ensures survival, by the time a constructive solution might come along, if it does at all, it's not needed anymore, has no effect, and NS is blind to it. This is why the beneficial (for immediate survival) but damaging (to the genetic code) mutations almost always prevail. This is explained in detail in Behe's Darwin Devolves and in Sanford's Genetic Entropy.
It's only logical that a random, unintelligent process would follow the principle of entropy. Information decreases in the system, parts of the genetic code are lost, and nothing new is created. If there's any actual innovation in organisms, it has to come from somewhere else.
So evolution (which really means surviving by mostly breaking the genetic code) is a 'proven fact' only on this low level. The rest is speculation, assumptions, and biased interpretation. The logic of "if this can happen in 20 years, imagine what can happen in 20 million years" is a fallacy. It's like showing that if you twist the Rubik's cube for 5 minutes, you can get some interesting colour patterns, and then claiming that if you continue for 5 years, the cube could become a car. There are limits to what any particular process can achieve. Darwinists insist that their random process is as omnipotent as the Creationists' God.
And it's not only RM that has limits. Natural selection is limited and even limiting too. If it took 5,000 mutations to evolve from one species to a significantly different one, and you were to introduce these mutations artificially, one every few generations, NS would actually be working against you because 99% of the mutations wouldn't be of any use on their own, so there would be no benefit for survival. And as we've seen, building something that isn't useful (yet) costs energy, so the prevailing tendency is to lose things, not gain them. NS is helpful, but only for things that are immediately beneficial for survival. Mostly this means single mutations only.
Creating something new by RM is an uphill battle even with NS. From Genetic Entropy:
The overwhelmingly deleterious nature of mutations can be seen by the incredible scarcity of clear cases of information-creating mutations. It must be understood that scientists have a very sensitive and extensive network for detecting information-creating mutations, and most geneticists are diligently keeping their eyes open for them all the time. This has been true for about 100 years. The sensitivity of this observational network is such that even if only one mutation out of a million unambiguously creates new information (apart from fine-tuning), the literature would be overflowing with reports of this happening. Yet I am still not convinced there is a single, crystal-clear example of a known mutation which unambiguously created information. There are certainly many mutations which have been described as beneficial, but most of these beneficial mutations have not created information, but rather have destroyed it. [...]So beneficial mutations are virtually nonexistent, but many damaging ones slip through NS, which is why we have things like genetic diseases. Organisms with damaging errors in their DNA can still survive and reproduce, and these errors happen infinitely more often than anything really beneficial, so the genetic code does degrade over time. The vast majority of mutations are near neutral, so they don't affect survival and thus are invisible to NS, but they constantly introduce more and more small errors to the genetic code. That's entropy in action.
During the last century, there was a great deal of effort invested in trying to use mutation to generate useful variation. This was especially true in my own area, plant breeding. When it was discovered that certain forms of radiation and certain chemicals were powerful mutagenic agents, millions and millions of plants were mutagenized and screened for possible improvements. [...] For several decades this was the main thrust of crop improvement research. Vast numbers of mutants were produced and screened, collectively representing many billions of mutation events. A huge number of small, sterile, sick, deformed, aberrant plants were produced. However, from all this effort, almost no meaningful crop improvement resulted. The effort was an enormous failure for the most part and was almost entirely abandoned. Why did this huge mutation/selection experiment fail even with a host of Ph.D. scientists trying to help it along? Because even with all those billions of mutations there were no significant new beneficial mutations arising.
Also bear in mind that mutations happen on the nucleotide level, while NS happens on the level of the whole organism. You may have many mutations in your body, some good, most bad, but the only thing that matters for NS is whether you as a whole survive long enough to reproduce. There's no way to sort out the different mutations.
The limited power of NS is more obvious the larger the organism is. It actually works best in bacteria and viruses, where a single mutation can make a visible difference. But in a mammalian body, a single mutation, unless it breaks something really badly, will in almost all cases be invisible, drowned in thousands of other features, and won't result in any significant survival rate change. And because deleterious mutations are thousands of times more common than beneficial ones, the normal state of any organism is that it contains thousands of small, deleterious mutations. If a beneficial mutation appears, it can only survive by taking all these deleterious ones along for the ride. The overall damage is always larger than the gain. At no point will any organism have more beneficial mutations than deleterious ones.
Darwinists view NS almost as a God that can, with utmost precision, choose what survives and what doesn't. But there is no precision. 'Dumb luck' has more to do with survival than NS. As Sanford points out, if a whale swallows a few thousand shrimp in one bite, does it swallow the least fit ones? No, it's random. If salmon are swimming upstream to lay eggs, and a bear is waiting for them to catch some, what are the chances that the bear will get the least fit specimens? Pretty much zero. There are very few cases when it's actually natural selection that makes the choice, rather than any number of other factors.
NS mainly eliminates those who are so damaged that they really can't keep up with the rest. Bacteria developing resistance to drugs is one of the few examples where NS "favours something new". This is a case where a significant difference can be made with minimal effort, because it's just one mutation in a small organism. Again, in a larger organism, a single mutation is very unlikely to be visible to NS. But there's no selecting for the mutants. The selection can only be against the non-mutants. The selection here works only because the drug is literally killing off all the non-mutants. NS has no creative power. It can only eliminate. Something new that's useful will survive. But so will the normal organisms that have been surviving all along, at about the same rate, unless conditions have changed significantly. For the most part, the job of NS is to try to preserve the genetic code as it is, to prevent it from degrading. Mutations are degrading it all the time, but NS can eliminate only the worst ones. If a beneficial mutation appears, it appears in an organism that already has accumulated hundreds of small deleterious mutations, so even if the organism survives, the code is still degrading. The only thing NS can do is remove from the gene pool organisms that, for whatever reason, fail to reproduce. There is simply no way forward, in the long run. Not by this process anyway.
And keep in mind that even for the bacteria, you need thousands of generations and billions of specimens for one significantly useful mutation to show up. Bacteria just go through that process really quickly. For mammals, such a mutation might take a million years to appear, and then NS still wouldn't even see it in most cases.
Let us suppose, for the sake of argument, that a wolf gets born that can run twice as fast as the other wolves. This is, of course, completely unrealistic for a random mutation to achieve, but let's try it anyway. It would be about as much as RM can be hoped to offer to NS to work with. The question here is, what can natural selection really do about it? Darwinists will claim that it will 'select for it', and just automatically assume that wolves as a species have evolved to be twice as fast this way. But this is very naive. What really happens in reality? We can safely assume this wolf will have no trouble at all catching prey. We may even assume it will eat literally any time it wants. (Though that may not necessarily be true due to low availability of prey and other conditions.) But what can NS do about this? The wolf survives, sure. But how does it affect the other wolves? They can still catch prey at exactly the same rate they did before. Natural selection can only favour this wolf by eliminating other wolves. It can't make this one reproduce more. It can only kill off other wolves if they're unable to survive. But this new wolf's ability to survive has not decreased the other wolves' ability to survive. Very much less so when they hunt in packs and whenever prey is caught, they all eat. In this case, the advantage is transferred to the whole group, but the whole group doesn't spread the new wolf's genes. (Here's where Dawkins's dumb idea of selfish genes can be seen to not work.) So while this wolf and its progeny may survive easily, their genes may be expected to spread only marginally better than just by genetic drift. This is pretty far from 'wolves evolving to be faster'. And note that this wolf is still prone to injury (maybe more than others!), disease, cold, human hunting, and all the other things that threaten wolves (never mind that any such mutation is very likely to break something else in the wolf's genome.) So even if such an amazing and improbable evolutionary step occurred, there's still a decent chance that the wolf will die by bad luck. And this bad luck is far more likely than the mutation was in the first place.
The amazing power of NS as it exists in Dawkins's imagination does not exist in the real world. And it's ironic but very telling that single-celled bacteria, in which NS is more powerful than in the more complex organisms, had not evolved much for two billion years.
Which brings us to another of the many problems with Darwinism, the well-known Cambrian explosion. For two billion years, only single-celled organisms existed, without producing anything complex. This makes perfect sense. What doesn't make any sense (from the Darwinian perspective) is that then, suddenly, in some 20 million years, most major animal phyla appeared in all their complexity. The Darwinian prediction is that things evolve slowly at a fairly constant rate. The Cambrian explosion stands in complete opposition to this theory. Of course Darwinists, who begin with a pre-formed belief - that evolution is true - and then try to twist the facts to fit the conclusion, have all kinds of really lame excuses for this that we won't even get into here.
The funny thing to consider is that if anything in this image is caused by random mutations, it is more likely to be the decline of species rather than their creation. Rather than the evolution of species, random mutation is more likely to play a role their extinction. The irony of that fact is epic.
Something else that Darwinists regularly confuse is 'consistent with' and 'evidence for'. Wherever they see something that's even remotely consistent with evolution, they claim it's evidence for evolution. It doesn't occur to them that, aside from this being a fallacy, 90% of the time this said 'evidence' is actually also consistent with the main competing theory - Intelligent Design.
Common Ancestry
Common ancestry is not actually proven. It's not a fact; it's an interpretation of a fact, the fact that different organisms look anatomically similar and thus are presumably related. But are we looking at common ancestry or a common designer? Similarity of design of different organisms makes perfect sense from the point of view of ID. If you're going to design a new car, are you going to design it from scratch, including reinventing the wheel? Of course not. You'll start with a car that's close to what you want and make modifications of your choice. Similarity of anatomy is no proof of evolution, especially when it fits the opposing theory just fine. Of course this is where Darwinists really embarrass themselves by telling you how God would or wouldn't design things. Being materialist atheists who deny the existence of anything approaching an idea of God, Darwinists are of course the chief experts on what God would or wouldn't do.
If you line up a hundred different cars and invite a Darwinist from another planet where there are no cars to take a look, he will immediately see the common ancestry of these cars, the homology, and clear evidence that these cars evolved from one ancestor, and that there's absolutely no need for design. He'll be able to line up the cars in the order in which they had probably evolved. Clear evidence, right? Nobody designed the cars. This may seem silly, but it's really quite an accurate analogy for how Darwinists 'prove' common ancestry. Of course similarity of structure is not proof of common design either! It's just a resemblance, consistent with both theories, that can be interpreted in different ways, as I warned at the beginning of this article. But Darwinists use it as 'proof' of evolution, which is false proof.
I won't even try to get into the case of humans specifically. Humans in the context of evolution are such a controversial topic that there are many books dealing with just that. The question of how humans evolved into what they are today involves many mysteries that nobody has been able to resolve definitely. And natural selection doesn't work at all in the case of humans, except for genetic damage so bad that you die as a child or are sterile. Do smarter people reproduce more than stupid ones? No. Do fit people who exercise reproduce more than lazy, fat people? No.
So what can random mutation and natural selection really do? Let's have a look.
Can a wolf evolve into a dog or a fox? Probably. (If you can call it evolving. I'd say it's just adaptation to environment.) They have the same skeletal structure, organs, fur, same number of legs etc. Only a change of sizes and colours would be needed. Simple mutations can do the job.
Can a wolf evolve into an eagle or an elephant? No. Randomness, one step at a time, doesn't create functional wings or tusks where there was no genetic code for them before.
What can a fish evolve into? Other fish.
What can a fish not evolve into? An eagle, an elephant, an ant, a human, a palm tree, or really anything that's not a fish.
We could say that micro-evolution works and macro-evolution doesn't.
To quickly recapitulate the various problems of Darwinism:
- Origin of life inexplicable (more on this in part 3)
- Sophisticated, functional, complex code cannot arise accidentally
- Random processes are not creative
- Most mutations have little to no impact on survival but degrade the code
- Natural selection is powerless in most cases
- Irreducible (or any decent) complexity can't be overcome by RM+NS
- Deleterious mutations overpower beneficial ones thousands to one
- The fossil record doesn't support the Darwinist model
- Observations and experiments have only shown very simple adaptation and broken genes
- Mutations induced by radiation don't result in any improvement, just damage
- Similarity of structure is not evidence for evolution
- Much "evidence" for evolution is known to be fake yet keeps being shown
- The idea that given enough time, anything is possible, is a fallacy
As science of the last half a century or so has shown, the combination of RM+NS has a very limited scope of action, and thus something else has to account for all the complexity of life that we see around us.
If neither Creationism nor Darwinism Has the Answers, Then What Does?
Creationism is a fairy tale supported by a dubious book, and Darwinism is a zombie science full of wishful thinking, trying to keep alive something that has long since died. How, then, do we explain all this life around us? This is where we get into more speculative territory. You're free to draw your own conclusions, but I will offer some suggestions that may be worth considering.
One of them is the possibility that evolution somehow happens, at least to some extent, by other means than random mutation. Perry Marshall, in his book Evolution 2.0, proposes exactly that. Here's a part of his bullet point summary:
- Neo-Darwinism says Random Mutation + Natural Selection + Time = Evolution.
- Random mutation is noise. Noise destroys.
- Cells rearrange DNA according to precise rules (Transposition).
- Cells exchange DNA with other cells (Horizontal Gene Transfer).
- Cells communicate with each other and edit their own genomes with incredibly sophisticated language.
- Cells switch code on and off for themselves and their progeny (Epigenetics).
- Cells merge and cooperate (Symbiogenesis).
- Species 1 + Species 2 = New Species (Hybridization). We know organisms rapidly adapt because scientists produce new species in the lab every day.
- Adaptive Mutation + Natural Selection + Time = Evolution 2.0.
Darwinists stubbornly stick to their idea that 'randomness improves things and creates order'. They don't like God, and they apparently don't like any kind of intelligence either. Marshall gives an example of this avoidance:
"In 2009, the famous atheist Richard Dawkins published his thick, best-selling book The Greatest Show on Earth. In it, he states that evolution is driven by random changes in genes. It is worth noting that in all of 450 pages of The Greatest Show on Earth . . .Because Dawkins has his own agenda, and after all these years, he's unlikely to change it. This book of his was supposed to explain why evolution is true. But throughout the book, instead of explaining the Theory of Evolution with some facts, he just mentions some facts and explains them with the Theory of Evolution. I don't think he understands much about facts, evidence, or objectivity. If you read his books, your knowledge of life and biology is likely to get worse because of all the misconceptions he proffers.Why didn't Dawkins grant so much as three pages to the five best-documented mechanisms of evolution? Why does he act as though the last 50 years of microbiology and billions of dollars of research never happened? Oxford University's former "Professor of the Public Understanding of Science" wrote one of the most popular evolution books of the last decade, for which he received large advances and rode huge waves of media publicity.
- Symbiogenesis is never mentioned.
- Horizontal Gene Transfer is briefly touched on once, downplayed and presented as scarcely ever crossing from one species to another.
- Epigenetics gets one tiny footnote in chapter 8. He breezily shrugs it off as a "modest buzzword" and "confused theory that will enjoy 15 minutes of fame." (At the time of this writing, "Epigenetics" is a major focus in genomics and appears 129,000 times in Google Scholar. The number of entries has doubled in the last two years - clearly a hot field of research.)
- Transposition is never mentioned.
- Genome Duplication is never mentioned.
So why isn't he disclosing this?"
I don't know how much the Evolution 2.0 theory can really explain though. I don't think it can get us from fish to a tiger, and I'm not buying that it could have caused the Cambrian explosion. The simple reason is that if this is something that organisms have had at their disposal the whole time, there seems to be no explicable cause for using it a thousand times more within a certain relatively short era than in all the other eras. This is the same reason random mutations couldn't explain it either, even if they actually worked decently, which they don't. In fact, it doesn't seem like any natural process could explain the Cambrian explosion. The jump in perceived evolution there is so huge that there doesn't seem to be any way conditions could have changed so drastically that life could suddenly evolve on its own at a rate several orders of magnitude faster than ever, especially if almost all you had before that was on the level of bacteria.
To me, it looks more like somebody decided to step up the 'Life on Earth' experiment. But before we get to that, there's a more significant issue.
The Origin of Life
Darwin didn't concern himself with the origin of life. He simply acknowledged that life began somehow, and his concern was how it evolved from there. Neo-Darwinists, of course, had to do better than that to be taken seriously in the 20th century, but they haven't achieved that goal. If you want to know what happened 'at the beginning' and sort through the relevant literature, you'll find it frustrating because the answers simply aren't there. Lots of speculation, much of it quite silly, but nothing clear.
You'll find things like "the transition from non-living to living entities was not a single event, but a gradual process of increasing complexity". How does this make any sense? How do you get from non-life to life gradually? What are the intermediate stages? Something that isn't dead but not quite alive? Zombies? So much grasping at straws. In the end, after reading about many failed attempts at explaining how life came to be from non-life, you'll find that the simple and only true answer is that nobody has a clue. Anybody who tells you we know how life came to be from dead matter (or rather, 'nothing') is either lying to you or delusional.
There's the infamous Miller-Urey experiment that at one time was hailed as great progress because it was thought to show that some amino acids could arise spontaneously in nature, and it was presented as evidence for the creation of "the building blocks of life". The problem is that the phrase "building blocks of life" is misleading. Amino acids build proteins, and those are important in living organisms, but getting a few amino acids and claiming you've almost created life is akin to scribbling a few random symbols on a piece of paper and claiming you've almost created a language. When you have a few amino acids, you are nowhere near producing anything that even remotely resembles life. Just like when you have "if", "then", and "else", you're still nowhere near having a computer program, even if those three words may be considered the building blocks of software code. And even if the correct amino acids assembled in large numbers and correct order and formed a protein (a pure fantasy), then what? You have a protein, but without a fully functional cell, what can it do? Absolutely nothing.
Supposedly the first life was a bacterium. In order to reproduce, it needed DNA, various versions of RNA, some enzymes, ribosomes, etc. All of that is way too complex to be put together randomly. Even just DNA itself is too complex to be put together randomly, no matter how much time it takes. And you'd still need the other components to use the DNA. DNA is a code more sophisticated than any we have ever made, and there's absolutely no way in hell it came to be randomly. The only way we know of that a code can be created is if an intelligent mind designs it.
Marshall's comment on this is: "Origin of Life: Information theory says codes require a designer, or an undiscovered natural process that generates codes". If you discover a natural process that generates codes, you can win $5 Million USD. Yes, this is something that Marshall is offering, and has been for a while. You can go to this link and read the requirements. If you discover how DNA could have arisen spontaneously, you'll get rich, and Darwinism may have a chance. Of course, nobody has yet claimed the prize, and no one is likely to since codes really do require a designer, because that's how all the codes we know came to be.
It's clear that something as sophisticated as DNA - an incomprehensibly immense database of manuals for complex structures and processes - had to be designed. Nobody has been able to offer any plausible alternative. Darwinists are trying hard, even desperately, but they're stuck at "we don't have a clue" (or stupidly insist that it was all an accident). As I've mentioned, a cell that can reproduce needs to be far more complex than just DNA itself. This kind of complexity requires design. Some people equate intelligent design with God, because apparently they lack both imagination and common sense. A car is a product of ID. The Internet is a product of ID. Were they made by God? So why would anybody think ID means God? I'm not sure which part of "intelligent" or "design" sounds like "God".
The properties of DNA tell us that it was most likely the product of design, and the designer must have been much smarter than we are. Who could it be, then? Well, whoever it is, clearly they're not hanging around to give us a chance to chat with them. But let's look at it from a different perspective. We ourselves have been messing with genetic engineering for a while. There isn't really much stopping us from seeding life on another planet, should we find one with favourable conditions. So logistically, there's no reason why life on Earth couldn't have been seeded by somebody sort of like us. This is far more plausible than Creationist magic of 'God made stuff' and Darwinist magic of 'lol stuff just happens randomly'.
But if we were to seed life elsewhere, we'd have to use Earthly DNA, because we are nowhere near being able to actually create new life. Think about that; despite all our knowledge and intelligence and even though we have a basic understanding of how DNA works, we still can't design a code to create life. Despite this, Darwinists believe it happens all by itself, by 'accident'. But if somebody seeded life on Earth, they would likely have had the same DNA structure, which just shifts the issue of 'first origins' onto 'them' and doesn't explain the origin of DNA, but it would explain life on Earth. However it happened, and whoever was responsible, it is clear that the immensely sophisticated code for life on earth is a product of intelligent design of some kind. Just because we can't know the designer at this point, doesn't mean this inevitable conclusion is somehow less valid. And there's no reason to resort to God for the answer. To be fair, I also don't see any particular reason why there couldn't be something we might call God that created some life in the first place. There may be no evidence for it, but there is an equal lack of evidence against it, at least in theory, and remember, Darwinism is a theory!
As we get comfortable with the notion that the designer need not be God, it should be easier to understand any possible imperfections in the design. If we were to seed life on another planet, I'm sure there would be plenty of mistakes. Dawkins regularly mocks the ID theory in his books with questions like "who in their right mind would design this?" and "why would an intelligent designer design it this way?" Presumably Dawkins knows the biology of all creatures so perfectly that he knows how everything works and has worked in the past and can decide what's good and what's bad and he would design things better. Also he knows that design has to be perfect because, presumably, he has observed that humans have designed millions of things and all of them are absolutely perfect and without any flaws.
The last thing I want to mention here is consciousness. Darwinism, being a child of materialism, ignores consciousness as some kind of side-effect. This, in my opinion, is one of the biggest mistakes ever made in science. If you discard half of the Universe from your equations, how can you expect the output to make any sense? This is especially embarrassing since we've known for a long time from quantum mechanics that mind can affect matter. So the question we should probably be asking is: Could consciousness affect DNA in some way? Could, for example, certain prolonged mental or emotional states turn genes on and off? Can there be some kind of tuning between the body and mind?
Of course we don't know anything for certain in this regard because, given the materialism that underpins modern science, nobody is doing that kind of research, but many people believe it's a legitimate line of inquiry. Materialism can't explain DNA and life, and Darwinism can't explain evolution, so it's worth considering what role consciousness might play. And if there is a role, it's likely to not be random and thus more likely to account for something constructive than random mutations can. The main point here is that if both Creationism and Darwinism/materialism fail to describe reality, we need to explore other options with an open mind.
Of course, if you believe that materialism is true, that everything is matter, and consciousness is just an illusion, then these ideas aren't for you. You are, by your own admission, a gene-programmed biological robot with no free will, no purpose, no values, and your life ultimately has no meaning. There's no point in discussing anything with such people, because any discussion is just an inevitable result of our genes, with a predetermined outcome and no meaning. (Yes, this is how stupid materialism is, so let's not waste any more time on it.)
The Big Picture
How does this all fit together?
DNA had to be designed. I'm open to other options, but unless somebody wins that $5 million for figuring out how the most sophisticated code we know could just accidentally self-assemble, I think design is the only answer that makes any sense. If there's a designer, then it's reasonable to assume life came here from the 'outside'. Then RM and NS kicked in and life started to adapt and diversify a little. Bear in mind that nothing complex "evolved" for 2 billion years. That was an era that's actually consistent with Darwinism.
During the Cambrian explosion, as far as I'm concerned, 'somebody' had to add more life forms (a lot more), because we don't know of any natural process that could reasonably explain this kind of quantum leap. 'Accident' is not a serious explanation. It is very likely that something like this happened repeatedly, with the times after large-scale disasters and extinction events being good candidates.
Aside from an unknown number of such interventions, life here is left to its own devices. This means the Darwinist process of RM+NS accounts for some of the adaptation, Adaptive Mutation described in Evolution 2.0 may account for some more, and if consciousness plays a role, which is hard to know given the minimal attention given it by scientists, then consciousness may be responsible for some kind of evolution as well, possibly even more than the other mechanisms, for all we know.
For most of history, these natural processes were all that was going on. For all the 'missing links' and apparent quantum leaps, some kind of intelligent intervention from outside seems like the most probable explanation, since we have no scientifically plausible alternatives. The bottom line: functional complexity doesn't happen without some intelligence behind it.
We certainly don't have all the answers, and we may not find any in the near future, but we can move ourselves forward, in the right direction, by discarding ideas that contradict science. Random changes do not improve functionality. Ideology isn't science.
Recommended literature:
Michael J. Behe - Darwin's Black Box (1996)
Michael J. Behe - The Edge of Evolution (2008)
Michael J. Behe - Darwin Devolves (2019)
Jonathan Wells - Icons of Evolution (2002)
Perry Marshall - Evolution 2.0 (2015)
John Sanford - Genetic Entropy & the Mystery of the Genome (2005)












Læserkommentarer
dig vores Nyhedsbrev